Genome finishing
From CSBLwiki
(Difference between revisions)
(→Submission) |
|||
Line 78: | Line 78: | ||
==Submission== | ==Submission== | ||
[http://www.ncbi.nlm.nih.gov/projects/genome/assembly/submission/faq.shtml FAQ] | [http://www.ncbi.nlm.nih.gov/projects/genome/assembly/submission/faq.shtml FAQ] | ||
+ | [http://www.ncbi.nlm.nih.gov/genomes/static/Annotation_pipeline_README.txt PGAAP] | ||
==Reference== | ==Reference== |
Revision as of 12:33, 6 February 2011
Contents |
Annotation
사용 프로그램
- rRNA : rnammer
- tRNA : tRNAscan-SE
- CDS : glimmer3, GeneMarkHMM, Prodigal, blastp
- oriC : ori-finder
- viewer : artemis, DNAPlotter
- Total predicted CDS: 4576
- Hit - hypothetical protein: 1682
- No Hit: 991
통계
- rRNA : 5 operon(16s,23s,5s) + 5s rRNA (green)
- tRNA : 58 (blue)
- CDS : 4576 (red)
- oriC : 1 (cyan)
PCR
4 Gaps
- 6gap1
- repeat region
- 6gap2
- N : 2994.. 3061
- gb|EEG30450.1| hypothetical protein CLOSTMETH_01926 [Clostridium methylpentosum DSM5476] Length = 1188 q: 4..2811, s: 158..1072
- gb|ACV54125.1| Gene info linked to ACV54125.1 hypothetical protein Elen_0131 [Eggerthella lenta DSM 2243] Length=705 q:4828..6171, s:40..518
- 1gap
- N : 3025..3049
- gb|EDP12637.1| hypothetical protein CLOBOL_07199 [Clostridium bolteae ATCC BAA-613] Length = 1481 q: 924..3017, s: 7..697
- gb|EEG74299.1| hypothetical protein CLOHYLEM_05557 [Clostridium hylemonae DSM 15053] Length = 199 q: 3680..4279, s: 1..199
- filled!!
- 3_7gap
- Get PCR product!
pcr
8-1 | 8-6 | 8-3 | 3-7 | 7-8 | 8-2 | 2-8 | 8-5 | 5-8 | 8-4 | 4-8 | 6-7 | 1-3 | 1-6 |
L | L | L | L | L | L | L | L | L | L | L | L | L | |
P | P | A | P | A | A | P | A | P | P | A | ? |
- L: 454 PE link
- P: PCR
- A: Assemble
Arrange Scaffold
- Pieces
- 8-1
- 8-6
- 8-3(RC)-7-8
- 8-2-8
- 8-5-8
- 8-4-8
Sequencing
- Primer: Product
- 5tail-8head: ok
- 8tail-8head: 4tail-8head
- 1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨.
- 7head-3head: ok
- 5kb control- c1_4-c1_5: ok *gap -> CGTCTAAAAAATTATAATTTTTTAGACG
Submission
Reference
- Finishing Overview - PDF
- Consed--A Finishing Package (Editor, Autofinish, Autoreport, Autoedit, and Align Reads To Reference Sequence)
- Genomics Education - see some tutorials for finishing with Consed
- Automated Finishing with Autofinish
- Finishing genomes with limited resources: lessons from an ensemble of microbial genomes
- Google Search Result: genome+sequencing+finishing+pcr+protocol
- Good Blog