E. coli knockout

From CSBLwiki

(Difference between revisions)
Jump to: navigation, search
(Procedure)
(Notes)
Line 73: Line 73:
==== Notes ====
==== Notes ====
-
*Primers
+
*'''Primers'''
** For pKD 13 kanamycin cassette
** For pKD 13 kanamycin cassette
*** Foward: aaaaagaaaatgatgtactgctactccagcccgaggctgtgtgtaggctggagctgcttcg
*** Foward: aaaaagaaaatgatgtactgctactccagcccgaggctgtgtgtaggctggagctgcttcg
Line 81: Line 81:
*** Reverse: cgatgtttcgcttggtggtc
*** Reverse: cgatgtttcgcttggtggtc
-
*Sequences
+
*'''Sequences'''
**pKD13 Kanamycin cassette with FRT
**pKD13 Kanamycin cassette with FRT

Revision as of 01:44, 3 August 2010

Contents

E. coli Gene Replacement

Lambda red recombinase method

(see this link - openwetware::gene replacement - for the method comparison)

Materials

Procedure

  1. Grow up pKD46, pKD13, and pCP20 in proper host strains
  2. Perform minipreps to extract plasmids
  1. Pick the single colony containg pKD46
  2. Inoculate it to 5㎖ LB broth with ampicilline and L-arabinose
    • Prepare 2 samples. One is induced with L-arabinose and another is not induced.
    • L-arabinose final concentration is 0.2%.
  3. Incubate at 27℃, 120rpm until the culture OD reaches 0.6.(S17-1 lambda pir strain can reach that value for 16 hours incubation.)
  4. Centrifuge 3600rpm, for 5min at 4℃
  5. Wash with ice-cold 10% glycerol 3 times.
  6. Concetrate 100-fold
  1. Use 35㎕ competent cell and 300ng PCR product
  2. Pulse 2.5kV, 200Ω, 25㎌.
  3. Add prewarmed 1㎖ LB broth immediately
  4. Incubate 1 hour at 37℃.
  5. Spread one-half of the sample and incubate 37℃
    • If none grew within 24 hours, the remainder was spread after standing overnight at room temperature.

Notes

Personal tools
Namespaces
Variants
Actions
Site
Choi lab
Resources
Toolbox