E. coli knockout

From CSBLwiki

Revision as of 02:02, 3 August 2010 (view source) Csbl (Talk | contribs) (→Procedure) ← Older edit		Revision as of 02:03, 3 August 2010 (view source) Csbl (Talk | contribs) (→Procedure) Newer edit →
Line 42:		Line 42:
	***Overview is attached.  [[media:overview.jpg|File:Overview]]		***Overview is attached.  [[media:overview.jpg|File:Overview]]
	**PCR condition		**PCR condition
-	*** Anneling temparature and extension time is depend on the target sequence.	+	*** Anneling temparature and extension time depends on the target sequence.
	*** Anneling temparature is tested at 55℃ at first.		*** Anneling temparature is tested at 55℃ at first.
	*** Extension time is depend on the length of the target sequence. (1kb = about 1 min.)		*** Extension time is depend on the length of the target sequence. (1kb = about 1 min.)

---

Revision as of 02:03, 3 August 2010

Contents 1 E. coli Gene Replacement 1.1 Lambda red recombinase method 1.1.1 Materials 1.1.2 Procedure 1.1.3 Notes

E. coli Gene Replacement

Lambda red recombinase method

(see this link - openwetware::gene replacement - for the method comparison)

Materials

• Plasmids
  • pKD46 -sequence info.
    • Coding lambda red recombinase
    • Ampiciline resistance
    • Temperature sensitive replication origin
  • pKD13 - sequence info.
    • 3.4kb, KanR flanking FRT sequence, R6K gamma replication origin
    • Kanamycin resistance gene template plasmid
  • pCP20
    • Flipase system
    • Ampiciline and chloramphenicol resistance
    • Temperature sensitive replication origin
• Reagents
  • L-arabinose
    • Lambda red recombinase pBAD promoter inducer
• Equipment
  • Incubators (30°C and 37°C)
  • Electroporator

Procedure

• Preparation of plasmids

1. Grow up pKD46, pKD13, and pCP20 in proper host strains
2. Perform minipreps to extract plasmids

• Transformation of pKD46 to target strain
  • Preparation of competent cells
    • Using the protocol of TSS method - TSS method.

• Generation of cassette flanked by homologous arms
  • Design of primers
    • Primers have overhangs which were homologous to surrounding region of target gene.
    • Sequences from cassette region have about 60℃ Tm-value.
    • Overview is attached. File:Overview
  • PCR condition
    • Anneling temparature and extension time depends on the target sequence.
    • Anneling temparature is tested at 55℃ at first.
    • Extension time is depend on the length of the target sequence. (1kb = about 1 min.)
    • Detail conditions are shown below.
      

      
  • Treatment of PCR products
    • Method 1.
      • Takes more time and product concentration is lower than method 2. But template vectors remain less.
    • Method 2.
      • Takes less time and get high yield of products. Templates can be remained.(But it's not affect critically to transformation.)
  • How about 2nd PCR? (to remove contaminant template DNA)

• Making competent cells

1. Pick the single colony containg pKD46
2. Inoculate it to 5㎖ LB broth with ampicilline and L-arabinose
   • Prepare 2 samples. One is induced with L-arabinose and another is not induced.
   • L-arabinose final concentration is 0.2%.
3. Incubate at 27℃, 120rpm until the culture OD reaches 0.6.(S17-1 lambda pir strain can reach that value for 16 hours incubation.)
4. Centrifuge 3600rpm, for 5min at 4℃
5. Wash with ice-cold 10% glycerol 3 times.
6. Concetrate 100-fold

• Electroporation

1. Use 35㎕ competent cell and 300ng PCR product
2. Pulse 2.5kV, 200Ω, 25㎌.
3. Add prewarmed 1㎖ LB broth immediately
4. Incubate 1 hour at 37℃.
5. Spread one-half of the sample and incubate 37℃
   • If none grew within 24 hours, the remainder was spread after standing overnight at room temperature.

Notes

• Primers
  • For pKD 13 kanamycin cassette
    • Foward: aaaaagaaaatgatgtactgctactccagcccgaggctgtgtgtaggctggagctgcttcg
    • Reverse: aacgttggtattatttcccgcagacatgacccttttagcaattccggggatccgtcgacc
  • For confirmation of Knockout
    • Foward: cggctttcggcaattactcc
    • Reverse: cgatgtttcgcttggtggtc

• Sequences
  • pKD13 Kanamycin cassette with FRT