Genome finishing

From CSBLwiki

Revision as of 01:25, 16 August 2010 (view source) Csbl (Talk | contribs) (→Arrange Scaffold) ← Older edit		Revision as of 03:35, 16 August 2010 (view source) Csbl (Talk | contribs) (→Sequencing) Newer edit →
Line 11:		Line 11:
	===Sequencing===		===Sequencing===
	*Primer: Product		*Primer: Product
-	#5tail-8head: ok	+	#5tail-8head: ok
	#8tail-8head: 4tail-8head		#8tail-8head: 4tail-8head
	#1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨.		#1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨.
-	#7head-3head	+	#7head-3head: ok
		+	#5kb control- c1_4-c1_5: ok *gap -> CGTCTAAAAAATTATAATTTTTTAGACG
	==Reference==		==Reference==

---

Revision as of 03:35, 16 August 2010

Contents 1 PCR 1.1 Arrange Scaffold 1.2 Sequencing 2 Reference

PCR

Arrange Scaffold

• Pieces
  • 8-1
  • 8-6
  • 8-3(RC)-7-8
  • 8-2-8
  • 8-5-8
  • 8-4-8

Sequencing

• Primer: Product

1. 5tail-8head: ok
2. 8tail-8head: 4tail-8head
3. 1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨.
4. 7head-3head: ok
5. 5kb control- c1_4-c1_5: ok *gap -> CGTCTAAAAAATTATAATTTTTTAGACG

Reference

• Finishing Overview - PDF
• Consed--A Finishing Package (Editor, Autofinish, Autoreport, Autoedit, and Align Reads To Reference Sequence)
• Genomics Education - see some tutorials for finishing with Consed
• Automated Finishing with Autofinish
• Finishing genomes with limited resources: lessons from an ensemble of microbial genomes
• Google Search Result: genome+sequencing+finishing+pcr+protocol