Genome finishing
From CSBLwiki
(Difference between revisions)
(→Arrange Scaffold) |
(→Sequencing) |
||
Line 11: | Line 11: | ||
===Sequencing=== | ===Sequencing=== | ||
*Primer: Product | *Primer: Product | ||
- | #5tail-8head: ok | + | #5tail-8head: ok |
#8tail-8head: 4tail-8head | #8tail-8head: 4tail-8head | ||
#1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨. | #1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨. | ||
- | #7head-3head | + | #7head-3head: ok |
+ | #5kb control- c1_4-c1_5: ok *gap -> CGTCTAAAAAATTATAATTTTTTAGACG | ||
==Reference== | ==Reference== |
Revision as of 03:35, 16 August 2010
Contents |
PCR
Arrange Scaffold
- Pieces
- 8-1
- 8-6
- 8-3(RC)-7-8
- 8-2-8
- 8-5-8
- 8-4-8
Sequencing
- Primer: Product
- 5tail-8head: ok
- 8tail-8head: 4tail-8head
- 1tail-3head: 7head-3head - 1tail primer의 중간부터 끝 부분이 7 head에 붙은 것으로 생각됨.
- 7head-3head: ok
- 5kb control- c1_4-c1_5: ok *gap -> CGTCTAAAAAATTATAATTTTTTAGACG
Reference
- Finishing Overview - PDF
- Consed--A Finishing Package (Editor, Autofinish, Autoreport, Autoedit, and Align Reads To Reference Sequence)
- Genomics Education - see some tutorials for finishing with Consed
- Automated Finishing with Autofinish
- Finishing genomes with limited resources: lessons from an ensemble of microbial genomes
- Google Search Result: genome+sequencing+finishing+pcr+protocol