Knockout1
From CSBLwiki
(Difference between revisions)
(→Procedure) |
(→Procedure) |
||
| Line 37: | Line 37: | ||
**PCR program | **PCR program | ||
*** 94°C 1min → 30*[98°C 11s → 55°C 30s → 72°C 2min] → 72°C 5min | *** 94°C 1min → 30*[98°C 11s → 55°C 30s → 72°C 2min] → 72°C 5min | ||
| + | ::{| {{table}} | ||
| + | | align="center" style="background:#f0f0f0;"|'''Contents''' | ||
| + | | align="center" style="background:#f0f0f0;"|'''Concentration''' | ||
| + | | align="center" style="background:#f0f0f0;"|'''Volume''' | ||
| + | |- | ||
| + | | pKD3 template||45 ng/{{ul}}||0.5 {{ul}} | ||
| + | |- | ||
| + | | forward primer||10 {{um}}||5 {{ul}} | ||
| + | |- | ||
| + | | reverse primer||10 {{um}}||5 {{ul}} | ||
| + | |- | ||
| + | | 10x KOD buffer||-||10 {{ul}} | ||
| + | |- | ||
| + | | dNTP||2 mM||10 {{ul}} | ||
| + | |- | ||
| + | | {{mgso4}}||25 mM||4 {{ul}} | ||
| + | |- | ||
| + | | KOD polymerase||||2 {{ul}} | ||
| + | |- | ||
| + | | d{{h2o}}||-||64.5 {{ul}} | ||
| + | |} | ||
Revision as of 09:00, 21 October 2010
Contents |
Gene replacement
- target gene: yfaL
Materials
- Plasmids
- pKD46, pKD13, pCP20 - see this link
- Target gene
- yfaL
- an AmpR and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis (Datsenko and Wanner paper [1])
- yfaL
- Reagents
- L-arabinose
- Lambda red recombinase pBAD promoter inducer
- L-arabinose
- Equipment
- Incubators (30°C and 37°C)
- Electroporator
Procedure
- Preparation of plasmids
- Grow up pKD46, pKD13, and pCP20 in proper host strains
- Perform minipreps to extract plasmids
- Transformation of pKD46 to target strain
- Preparation of competent cells
- Using the protocol of TSS method - TSS method.
- Target strain - BW25113, Top10
- Preparation of competent cells
- Generation of cassette flanked by homologous arms
- Design of primers
- Primers have overhangs which were homologous to surrounding region of target gene.
- Sequences from cassette region have about 60℃ Tm-value.
- PCR condition
- Anneling temparature and extension time depends on the target sequence.
- Anneling temparature is tested at 55℃ at first.
- Extension time is depend on the length of the target sequence. (1kb = about 1 min.)
- PCR program
- 94°C 1min → 30*[98°C 11s → 55°C 30s → 72°C 2min] → 72°C 5min
- Design of primers
Contents Concentration Volume pKD3 template 45 ng/Template:Ul 0.5 Template:Ul forward primer 10 Template:Um 5 Template:Ul reverse primer 10 Template:Um 5 Template:Ul 10x KOD buffer - 10 Template:Ul dNTP 2 mM 10 Template:Ul Template:Mgso4 25 mM 4 Template:Ul KOD polymerase 2 Template:Ul dTemplate:H2o - 64.5 Template:Ul
- Making competent cells
- Pick the single colony containg pKD46.
- Inoculate it to 5㎖ LB broth with ampicilline and L-arabinose.
- L-arabinose final concentration is 1mM.
- Incubate at 27℃, 180rpm until the culture OD reaches 0.6.
- Centrifuge 3600rpm, for 5min at 4℃.
- Wash with ice-cold 10% glycerol 3 times.
- Concetrate 100-fold.
- Electroporation
- Use 30㎕ competent cell and 300ng PCR product.
- Pulse 2.5kV, 200Ω, 25㎌.
- Add prewarmed 1㎖ LB broth immediately.
- Incubate 2 hour at 37℃.
- Spread one-tenth of the sample and incubate at 37℃.
Notes
- Primers
- For pKD 13 kanamycin cassette
- Foward: ATGCGGATTATCTTTCTACGCAAGGAGTATTTATCTTTACaATTCCGGGGATCCGTCGACC
- Reverse: gcgcccctgccagcacgtagtgtgtaggctggagctgcttcggccggttagcgccatcggct
- For confirmation of Knockout
- Foward: GTTTCATGCAGACTACCTGTAGTACG
- Reverse: ctgcctcgtcctgcagttcattca
- For pKD 13 kanamycin cassette
- Sequences
- pKD13 Kanamycin cassette with FRT
