Knockout1

From CSBLwiki

Revision as of 01:37, 22 October 2010 (view source) Csbl (Talk | contribs) (→Notes) ← Older edit		Revision as of 01:48, 22 October 2010 (view source) Csbl (Talk | contribs) (→Procedure) Newer edit →
Line 48:		Line 48:
	| reverse primer||10 pmol||2㎕		| reverse primer||10 pmol||2㎕
	|-		|-
-	| 10x EX buffer||   ||5㎕	+	| 10x EX buffer|| ||5㎕
	|-		|-
	| dNTP||2 mM||2㎕		| dNTP||2 mM||2㎕
	|-		|-
-	| EX-tag polymerase||   ||0.5㎕	+	| EX-tag polymerase||5unit/㎕||0.5㎕
	|-		|-
	| D.W.||  ||37.5㎕		| D.W.||  ||37.5㎕
Line 78:		Line 78:
	# Add prewarmed 1㎖ LB broth immediately.		# Add prewarmed 1㎖ LB broth immediately.
	# Incubate 2 hour at 37℃.		# Incubate 2 hour at 37℃.
-	# Spread one-tenth of the sample and incubate at 37℃.	+	# Spread sample and incubate at 37℃.
-	#* Inoculate it to LB broth with 25㎍/ml kanamycin.	+	#* Plate on LB with 25 µg/ml Kan.
-		+	#* One-tenth portion was spread.
-	*'''	+
		+	*'''Colony PCR'''
	# Pick the single colony		# Pick the single colony
-	#	+	# 10㎕ D.W.
		+	#**PCR program
		+	*** 95°C  2min → 30*[95°C  20s → 55°C  20s → 72°C  2min]  →  72°C  5min
		+	::{| {{table}}
		+	| align="center" style="background:#F0E68C;"|'''Contents'''
		+	| align="center" style="background:#FFFACD;"|'''Conc.'''
		+	| align="center" style="background:#FFFACD;"|'''Vol.'''
		+	|-
		+	| template||  ||1㎕
		+	|-
		+	| forward primer||10 pmol||2㎕
		+	|-
		+	| reverse primer||10 pmol||2㎕
		+	|-
		+	| 10x α-tag buffer||  ||5㎕
		+	|-
		+	| dNTP||2 mM||2㎕
		+	|-
		+	| α-tag polymerase|| 2.5unit/㎕||0.5㎕
		+	|-
		+	| D.W.||  ||37.5㎕
		+	|-
		+	| Total||  ||50㎕
		+	|}
	==== Notes ====		==== Notes ====

---

Revision as of 01:48, 22 October 2010

Contents 1 Gene replacement 1.1 Materials 1.2 Procedure 1.3 Notes

Gene replacement

• target gene: yfaL

Materials

• Plasmids
  • pKD46, pKD13, pCP20 - see this link

• Target gene
  • yfaL
    • an AmpR and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis (Datsenko and Wanner paper [1])

• Reagents
  • L-arabinose
    • Lambda red recombinase pBAD promoter inducer
• Equipment
  • Incubators (30°C and 37°C)
  • Electroporator

Procedure

• Preparation of plasmids

1. Grow up pKD46, pKD13, and pCP20 in proper host strains
2. Perform minipreps to extract plasmids

• Transformation of pKD46 to target strain
  • Preparation of competent cells
    • Using the protocol of TSS method - TSS method.
    • Target strain - BW25113, Top10

• Generation of cassette flanked by homologous arms
  • Design of primers
    • Primers have overhangs which were homologous to surrounding region of target gene.
    • Sequences from cassette region have about 60℃ Tm-value.
  • PCR condition
    • Anneling temparature and extension time depends on the target sequence.
    • Anneling temparature is tested at 55℃ at first.
    • Extension time is depend on the length of the target sequence. (1kb = about 1 min.)
  • PCR program
    • 94°C 1min → 30*[98°C 11s → 55°C 30s → 72°C 2min] → 72°C 5min

Contents	Conc.	Vol.
pKD13 template	100 ng/㎕	1㎕
forward primer	10 pmol	2㎕
reverse primer	10 pmol	2㎕
10x EX buffer		5㎕
dNTP	2 mM	2㎕
EX-tag polymerase	5unit/㎕	0.5㎕
D.W.		37.5㎕
Total		50㎕

• Treatment of PCR products

1. Add 1㎕ of DpnⅠ to not purified PCR products.
2. Incubate at 37℃ about 2 hours.
3. These samples were purified in elution buffer.

• Making competent cells

1. Pick the single colony containg pKD46.
2. Inoculate it to 5㎖ LB broth with ampicilline and L-arabinose.
   • L-arabinose final concentration is 1mM.
3. Incubate at 27℃, 1800rpm until the culture OD reaches 0.6.
4. Centrifuge 3600rpm, for 5min at 4℃.
5. Wash with ice-cold 10% glycerol 3 times.
6. Concetrate 100-fold.
   • Efficiency is

• Electroporation

1. Use 30㎕ competent cell and 300ng PCR product.
2. Pulse 2.5kV, 200Ω, 25㎌.
3. Add prewarmed 1㎖ LB broth immediately.
4. Incubate 2 hour at 37℃.
5. Spread sample and incubate at 37℃.
   • Plate on LB with 25 µg/ml Kan.
   • One-tenth portion was spread.

• Colony PCR

1. Pick the single colony
2. 10㎕ D.W.
   • • PCR program

• • • 95°C 2min → 30*[95°C 20s → 55°C 20s → 72°C 2min] → 72°C 5min

Contents	Conc.	Vol.
template		1㎕
forward primer	10 pmol	2㎕
reverse primer	10 pmol	2㎕
10x α-tag buffer		5㎕
dNTP	2 mM	2㎕
α-tag polymerase	2.5unit/㎕	0.5㎕
D.W.		37.5㎕
Total		50㎕

Notes

• Primers
  • For pKD 13 kanamycin cassette
    • Foward: ATGCGGATTATCTTTCTACGCAAGGAGTATTTATCTTTACaATTCCGGGGATCCGTCGACC
    • Reverse: gcgcccctgccagcacgtagtgtgtaggctggagctgcttcggccggttagcgccatcggct
  • For confirmation of Knockout
    • Foward: GTTTCATGCAGACTACCTGTAGTACG
    • Reverse: ctgcctcgtcctgcagttcattca

• Sequences
  • pKD13 Kanamycin cassette with FRT