Knockout1
From CSBLwiki
Contents |
Gene replacement
- target gene: yfaL
Materials
- Plasmids
- pKD46, pKD13, pCP20 - see this link
- Target gene
- yfaL
- an AmpR and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis (Datsenko and Wanner paper [1])
- yfaL
- Reagents
- L-arabinose
- Lambda red recombinase pBAD promoter inducer
- L-arabinose
- Equipment
- Incubators (30°C and 37°C)
- Electroporator
Procedure
- Preparation of plasmids
- Grow up pKD46, pKD13, and pCP20 in proper host strains
- Perform minipreps to extract plasmids
- Transformation of pKD46 to target strain
- Preparation of competent cells
- Using the protocol of TSS method - TSS method.
- Target strain - BW25113, Top10
- Preparation of competent cells
- Generation of cassette flanked by homologous arms
- Design of primers
- Primers have overhangs which were homologous to surrounding region of target gene.
- Sequences from cassette region have about 60℃ Tm-value.
- PCR condition
- Anneling temparature and extension time depends on the target sequence.
- Anneling temparature is tested at 55℃ at first.
- Extension time is depend on the length of the target sequence. (1kb = about 1 min.)
- PCR program
- 94°C 1min → 30*[98°C 11s → 55°C 30s → 72°C 2min] → 72°C 5min
- Design of primers
Contents Conc. Vol. pKD13 template 45 ng/㎕ 1㎕ forward primer 10 pmol 2㎕ reverse primer 10 pmol 2㎕ 10x EX buffer 5㎕ dNTP 2 mM 2㎕ EX-tag polymerase 0.5㎕ D.W. 37.5㎕ Total 50㎕
- Treatment of PCR products
- Add 1㎕ of DpnⅠ to not purified PCR products.
- Incubate st 37℃ about 2 hours.
- These samples were purified in elution buffer.
- Making competent cells
- Pick the single colony containg pKD46.
- Inoculate it to 5㎖ LB broth with ampicilline and L-arabinose.
- L-arabinose final concentration is 1mM.
- Incubate at 27℃, 1800rpm until the culture OD reaches 0.6.
- Centrifuge 3600rpm, for 5min at 4℃.
- Wash with ice-cold 10% glycerol 3 times.
- Concetrate 100-fold.
- Electroporation
- Use 30㎕ competent cell and 300ng PCR product.
- Pulse 2.5kV, 200Ω, 25㎌.
- Add prewarmed 1㎖ LB broth immediately.
- Incubate 2 hour at 37℃.
- Spread one-tenth of the sample and incubate at 37℃.
- 25㎕/ml kanamycin
Notes
- Primers
- For pKD 13 kanamycin cassette
- Foward: ATGCGGATTATCTTTCTACGCAAGGAGTATTTATCTTTACaATTCCGGGGATCCGTCGACC
- Reverse: gcgcccctgccagcacgtagtgtgtaggctggagctgcttcggccggttagcgccatcggct
- For confirmation of Knockout
- Foward: GTTTCATGCAGACTACCTGTAGTACG
- Reverse: ctgcctcgtcctgcagttcattca
- For pKD 13 kanamycin cassette
- Sequences
- pKD13 Kanamycin cassette with FRT