User contributions
From CSBLwiki
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 02:29, 6 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 02:28, 6 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 00:34, 6 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 00:34, 6 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 10:00, 4 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 02:39, 1 April 2011 (diff | hist) Group meeting (→2011_Spring)
- 05:31, 31 March 2011 (diff | hist) Group meeting (→2011 Schedule)
- 01:42, 30 March 2011 (diff | hist) Group meeting (→2011_Spring)
- 01:23, 30 March 2011 (diff | hist) Group meeting (→2011_Spring)
- 02:02, 31 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 03:27, 26 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 02:26, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf3)
- 01:55, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf3)
- 01:53, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf4)
- 01:51, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf4)
- 01:44, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf3)
- 01:36, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf3)
- 01:35, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf1)
- 01:21, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→scf1)
- 01:12, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→ctg205)
- 01:09, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→List of primer)
- 01:09, 25 January 2011 (diff | hist) Primer Verrucosispora gap
- 00:53, 25 January 2011 (diff | hist) Primer Verrucosispora gap (→List of primer)
- 05:12, 24 January 2011 (diff | hist) Primer Verrucosispora gap (→List of primer)
- 05:11, 24 January 2011 (diff | hist) Primer Verrucosispora gap
- 02:41, 20 January 2011 (diff | hist) N Template:Tl (Created page with "{{[[Template:{{{1}}}|{{{1}}}]]}}<noinclude> {{Documentation}} </noinclude>") (top)
- 02:40, 20 January 2011 (diff | hist) N Template:Tlx (Created page with "<includeonly><tt><nowiki>{{</nowiki>{{#if:{{{subst|}}}|subst:}}[[{{{LANG|}}}{{{SISTER|}}}{{ns:Template}}:{{{1|}}}|{{{1|}}}]]<!-- -->{{#if:{{{2|}}}| |{{...") (top)
- 02:40, 20 January 2011 (diff | hist) N Template:Pp-meta/pagetype (Created page with "{{#ifeq:{{TALKSPACE}}|{{NAMESPACE}}|talk page| {{#switch:{{NAMESPACE}} |{{ns:}} = article |{{ns:File}} = file |{{ns:Template}} = template |{{ns:Cat...") (top)
- 02:37, 20 January 2011 (diff | hist) N Template:Cladogram (Created page with "{| style="border: 1px solid #ccc; background-color: white; margin-left: {{{left|{{#ifeq:{{{align|}}}|left|0|1}}}}}em; margin-right: {{{right|{{#ifeq:{{{align|}}}|left|1|0}}}}}em;...") (top)
- 02:34, 20 January 2011 (diff | hist) N Template:Namespace detect (Created page with "{{#switch: {{lc: <!--Lower case the result--> <!--If no or empty "demospace" parameter then detect namespace--> {{#if:{{{demospace|}}} | {{{demospace...") (top)
- 02:33, 20 January 2011 (diff | hist) N Template:Mbox (Created page with "{{ {{namespace detect | demospace = {{{demospace|}}} | main = ambox | talk = tmbox | file = imbox | category = cmbox | other = ombox }} | typ...") (top)
- 02:33, 20 January 2011 (diff | hist) N Wikipedia:Template test cases (Created page with "{{How-to}} {{shortcut||WP:TEMPTEST|WP:TESTCASE|WP:TESTCASES}} Templates are a very powerful feature of MediaWiki, but mistakes can be easily made, even by ...") (top)
- 02:32, 20 January 2011 (diff | hist) N Template:Main other (Created page with "{{#switch: <!--If no or empty "demospace" parameter then detect namespace--> {{#if:{{{demospace|}}} | {{lc: {{{demospace}}} }} <!--Use lower case "demospace"--> | {{#...") (top)
- 02:32, 20 January 2011 (diff | hist) N Template:Ombox/core (Created page with "<table class="plainlinks ombox {{#ifeq:{{{small}}}|yes|mbox-small}} {{#switch:{{{type|}}} | speedy = ombox-speedy | delete = ombox-delete | content = ombox-content | ...") (top)
- 02:31, 20 January 2011 (diff | hist) N Template:Ombox (Created page with "{{#ifeq:{{{small|}}}|yes | {{ombox/core | small = yes | type = {{{type|}}} | image = {{#if:{{{smallimage|}}}| {{{smallimage}}} | {{{image|}}} }} | imageright = {{#if:{{{...") (top)
- 02:30, 20 January 2011 (diff | hist) N Template:Template sandbox notice (Created page with "{{#ifexpr:0<noinclude>1</noinclude>+{{#ifeq:{{lc:{{SUBPAGENAME}}}}|{{lc:{{{subpage-name|sandbox}}}}} |1 |0 }} |{{ombox |image = link= |t...") (top)
- 02:27, 20 January 2011 (diff | hist) N Template:Template other (Created page with "{{#switch: <!--If no or empty "demospace" parameter then detect namespace--> {{#if:{{{demospace|}}} | {{lc: {{{demospace}}} }} <!--Use lower case "demospace"--> | {{#i...") (top)
- 02:27, 20 January 2011 (diff | hist) N Template:Template doc (Redirected page to Template:Documentation) (top)
- 02:26, 20 January 2011 (diff | hist) N Template:Purge (Created page with "<span class="noprint plainlinks purgelink">[{{fullurl:{{{page|{{FULLPAGENAME}}}}}|action=purge}} <span title="Purge this page">{{{1|Purge}}}</span>]</span><noinclude> {{documenta...") (top)
- 02:26, 20 January 2011 (diff | hist) N Template:Pp-template (Created page with "<includeonly>{{pp-meta |type={{#switch:{{{demolevel|{{#ifeq:{{PROTECTIONLEVEL:edit}}-{{PROTECTIONLEVEL:move}}|-sysop|move|{{PROTECTIONLEVEL:edit}}}}}}} |semi |autoconfirmed...") (top)
- 02:25, 20 January 2011 (diff | hist) N Template:Pp-meta (Created page with "{{#ifeq:{{#switch:{{lc:{{{type}}}}} |move=<!-- -->{{#ifeq: {{#switch:{{lc:{{{demolevel|undefined}}}}} |semi |autoconfirmed=autoconfirmed |adminis...") (top)
- 02:25, 20 January 2011 (diff | hist) N Template:Fmbox (Created page with "<table {{#if:{{{id|}}}|id="{{{id|}}}"}} class="plainlinks fmbox {{#switch:{{{type|}}} | warning = fmbox-warning | editnotice = fmbox-editnotice | system <!-- system =...") (top)
- 02:24, 20 January 2011 (diff | hist) N Template:Documentation/template page (Created page with "{{#switch: {{SUBPAGENAME}} | sandbox | testcases = {{BASEPAGENAME}} | #default = {{PAGENAME}} }}<noinclude>{{documentation|content= This subtemplate of {{tl|documentation}} is us...") (top)
- 02:23, 20 January 2011 (diff | hist) N Template:Documentation/start box2 (Created page with "{{documentation/start box | preload = {{{preload|}}} <!--Allow custom preloads--> | heading = {{{heading|¬}}} <!--Empty but defined means no header--> | heading-style = {{{h...") (top)
- 02:23, 20 January 2011 (diff | hist) N Template:Documentation/start box (Created page with "<!-- Start of green doc box --><div id="template-documentation" class="template-documentation iezoomfix"><!-- Add the heading at the top of the doc box: -->{{#ifeq: {{{headin...") (top)
- 02:23, 20 January 2011 (diff | hist) N Template:Documentation/end box2 (Created page with "{{documentation/end box | preload = {{{preload|}}} <!--Allow custom preloads--> | content = {{{content|}}} | link box = {{{link box|}}} <!--So "link box=off" works--> | docp...") (top)
- 02:22, 20 January 2011 (diff | hist) N Template:Documentation/end box (Created page with "<noinclude><div></noinclude><div style="clear: both;"></div><!--So right or left floating items don't stick out of the doc box.--> </div><!--End of green doc box--><!-- Link bo...") (top)
- 02:22, 20 January 2011 (diff | hist) N Template:Documentation/docspace (Created page with "{{#switch: {{SUBJECTSPACE}} | {{ns:0}} | {{ns:File}} | {{ns:MediaWiki}} | {{ns:Category}} = {{TALKSPACE}} | #default = {{SUBJECTSPACE}} }}<noinclude> {{documentation|co...") (top)
- 02:21, 20 January 2011 (diff | hist) N Template:Documentation subpage (Created page with "<includeonly>{{#ifeq: {{lc:{{SUBPAGENAME}}}} | {{{override|doc}}} | <!-- doc page --> </includeonly>{{ #ifeq: {{{doc-notice|show}}} | show | {{mbox | type = notic...") (top)
- 02:21, 20 January 2011 (diff | hist) N Template:Documentation (Created page with "<!-- Automatically add {{template sandbox notice}} when on a /sandbox page. -->{{#ifeq: {{SUBPAGENAME}} | sandbox | <div style="clear: both;"></div>{{template sandbox notice}} ...") (top)
- 02:20, 20 January 2011 (diff | hist) N Template:! (Created page with "|<noinclude>{{template doc}}</noinclude>") (top)
- 02:16, 20 January 2011 (diff | hist) N Template:Clade (Created page with "{| cellspacing=0 cellpadding=0 border=0 style="{{{style|}}}" | style="width:1.5em; border-bottom:{{{thickness|1}}}px {{{state1|solid}}} black; border-left: 0; border-top: 0; bord...") (top)
- 01:08, 19 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 01:08, 19 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 12:20, 18 January 2011 (diff | hist) Genome assembly (→Softwares)
- 12:15, 17 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 12:11, 17 January 2011 (diff | hist) Group meeting (→Computational biology group page)
- 11:55, 17 January 2011 (diff | hist) Group meeting (→Computational biology group page)
- 10:39, 17 January 2011 (diff | hist) Group meeting (→Computational biology group page)
- 05:00, 17 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 01:12, 17 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 01:01, 17 January 2011 (diff | hist) Group meeting (→Winter-Spring)
- 10:18, 16 January 2011 (diff | hist) Group meeting
- 10:17, 16 January 2011 (diff | hist) Group meeting (→2011)
- 10:13, 16 January 2011 (diff | hist) Group meeting (→2011)
- 10:11, 16 January 2011 (diff | hist) Group meeting
- 08:48, 16 January 2011 (diff | hist) Progress jihee
- 08:14, 16 January 2011 (diff | hist) Group meeting (→2011)
- 08:06, 16 January 2011 (diff | hist) Group meeting (→2011)
- 07:49, 16 January 2011 (diff | hist) Group meeting (→2011)
- 06:34, 11 January 2011 (diff | hist) Group meeting
- 06:26, 11 January 2011 (diff | hist) N Progress batman (Created page with "2011")
- 06:25, 11 January 2011 (diff | hist) Computational Biology Group
- 06:25, 11 January 2011 (diff | hist) Computational Biology Group
- 06:25, 11 January 2011 (diff | hist) Computational Biology Group
- 06:24, 11 January 2011 (diff | hist) Computational Biology Group
- 06:24, 11 January 2011 (diff | hist) Computational Biology Group
- 06:23, 11 January 2011 (diff | hist) N Progress gnusnah (Created page with "2011.01.11 랩미팅")
- 06:22, 11 January 2011 (diff | hist) Computational Biology Group
- 06:20, 11 January 2011 (diff | hist) N Computational Biology Group (Created page with "[Computation group Main page]")
- 12:46, 7 December 2010 (diff | hist) Genome2 (→Read)
- 12:26, 7 December 2010 (diff | hist) Genome2 (→Read)
- 12:23, 7 December 2010 (diff | hist) Genome2 (→Read)
- 13:22, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 13:21, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 13:21, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 13:19, 3 November 2010 (diff | hist) Primer Verrucosispora gap (→Primer Naming Format)
- 13:16, 3 November 2010 (diff | hist) Primer Verrucosispora gap (→Primer Naming Format)
- 12:57, 3 November 2010 (diff | hist) Primer Verrucosispora gap (→List of primer)
- 12:19, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 06:05, 3 November 2010 (diff | hist) Primer Verrucosispora gap (→Primer Naming Format)
- 05:59, 3 November 2010 (diff | hist) Primer Verrucosispora gap (→List of primer)
- 05:51, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 05:50, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 05:49, 3 November 2010 (diff | hist) Primer Verrucosispora gap
- 05:33, 3 November 2010 (diff | hist) N Primer Verrucosispora gap (Created page with " >scaffold00001_1_2_1105 CTCAGGTCAGGCAGGCGTGATGATCTCTTC >scaffold00001_1_2_529 TACTAACCTCGGGTCGGCGTGAGAGGAGATTG >scaffold00001_2_3_751 CAGAACTGGAGAACGTCCATGCTCGAGAAC >scaff...")
- 05:33, 3 November 2010 (diff | hist) Genome assembly3
- 01:59, 3 November 2010 (diff | hist) Genome assembly (→Softwares)
- 01:59, 3 November 2010 (diff | hist) Newbler (top)
- 01:58, 3 November 2010 (diff | hist) Newbler
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)