Verr Origin
From CSBLwiki
(Difference between revisions)
Line 1: | Line 1: | ||
- | *ParA is a component of the widely conserved ParABS system that partitions replicons during cell division | + | *ParA is a component of the widely conserved ParABS system that partitions replicons during cell division. |
**[http://www.pnas.org/content/103/42/15582.full|Michael P. McLeod et al., The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, PNAS 2006 103 (42) 15582-15587; published ahead of print October 9, 2006, doi:10.1073/pnas.0607048103 ] | **[http://www.pnas.org/content/103/42/15582.full|Michael P. McLeod et al., The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, PNAS 2006 103 (42) 15582-15587; published ahead of print October 9, 2006, doi:10.1073/pnas.0607048103 ] | ||
**[http://www.pnas.org/content/97/26/14656.abstract?ijkey=3a56e232836229ad58a71f08a9b19bdfbff7a76f&keytype2=tf_ipsecsha|Yoshiharu Yamaichi and Hironori Niki, Active segregation by the Bacillus subtilis partitioning system in Escherichia coli, PNAS 2000 97 (26) 14656-14661] | **[http://www.pnas.org/content/97/26/14656.abstract?ijkey=3a56e232836229ad58a71f08a9b19bdfbff7a76f&keytype2=tf_ipsecsha|Yoshiharu Yamaichi and Hironori Niki, Active segregation by the Bacillus subtilis partitioning system in Escherichia coli, PNAS 2000 97 (26) 14656-14661] |
Revision as of 07:23, 6 February 2011
- ParA is a component of the widely conserved ParABS system that partitions replicons during cell division.
- P. McLeod et al., The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, PNAS 2006 103 (42) 15582-15587; published ahead of print October 9, 2006, doi:10.1073/pnas.0607048103
- Yamaichi and Hironori Niki, Active segregation by the Bacillus subtilis partitioning system in Escherichia coli, PNAS 2000 97 (26) 14656-14661
BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= scaffold00005 length=58295 (58,295 letters) Database: dnaA.blast 1231 sequences; 1,647,534 total letters Searching...done Score E Sequences producing significant alignments: (bits) Value 111017022:c3866199-3865186 Rhodococcus sp. RHA1, parA 70 9e-11 >111017022:c3866199-3865186 Rhodococcus sp. RHA1, parA Length = 1014 Score = 69.9 bits (35), Expect = 9e-11 Identities = 47/51 (92%) Strand = Plus / Plus Query: 7245 tcgccaaccagaaaggcggcgtcggcaagacgaccctcgccgtcaacctcg 7295 ||||||||||||| ||||||||||||||||||||| ||| |||||||||| Sbjct: 233 tcgccaaccagaagggcggcgtcggcaagacgaccagcgcggtcaacctcg 283 Database: dnaA.blast Posted date: Jun 26, 2007 7:49 PM Number of letters in database: 1,647,534 Number of sequences in database: 1231 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 70,760 Number of Sequences: 1231 Number of extensions: 70760 Number of successful extensions: 6965 Number of sequences better than 1.0e-10: 1 Number of HSP's better than 0.0 without gapping: 1 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 6954 Number of HSP's gapped (non-prelim): 11 length of query: 58,295 length of database: 1,647,534 effective HSP length: 19 effective length of query: 58,276 effective length of database: 1,624,145 effective search space: 94648674020 effective search space used: 94648674020 T: 0 A: 0 X1: 11 (21.8 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 35 (69.9 bits)