From CSBLwiki

Latest revision as of 13:03, 6 February 2011

Indicator gene

• ParA is a component of the widely conserved ParABS system that partitions replicons during cell division.
  • P. McLeod et al., The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, PNAS 2006 103 (42) 15582-15587; published ahead of print October 9, 2006, doi:10.1073/pnas.0607048103
  • Yamaichi and Hironori Niki, Active segregation by the Bacillus subtilis partitioning system in Escherichia coli, PNAS 2000 97 (26) 14656-14661

BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402. 

Query= scaffold00005  length=58295
         (58,295 letters)

Database: dnaA.blast 
           1231 sequences; 1,647,534 total letters

Searching...done


                                                                  Score    E
Sequences producing significant alignments:                      (bits) Value

111017022:c3866199-3865186  Rhodococcus sp. RHA1, parA             70   9e-11 


>111017022:c3866199-3865186 Rhodococcus sp. RHA1, parA
          Length = 1014

 Score = 69.9 bits (35), Expect = 9e-11
 Identities = 47/51 (92%)
 Strand = Plus / Plus 

                                                               
Query: 7245 tcgccaaccagaaaggcggcgtcggcaagacgaccctcgccgtcaacctcg 7295
            ||||||||||||| |||||||||||||||||||||  ||| ||||||||||
Sbjct: 233  tcgccaaccagaagggcggcgtcggcaagacgaccagcgcggtcaacctcg 283




 Database: dnaA.blast
   Posted date:  Jun 26, 2007  7:49 PM
 Number of letters in database: 1,647,534
 Number of sequences in database:  1231
  
Lambda     K      H 
    1.37    0.711     1.31  

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,760
Number of Sequences: 1231
Number of extensions: 70760
Number of successful extensions: 6965
Number of sequences better than 1.0e-10: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6954
Number of HSP's gapped (non-prelim): 11
length of query: 58,295
length of database: 1,647,534
effective HSP length: 19
effective length of query: 58,276
effective length of database: 1,624,145
effective search space: 94648674020
effective search space used: 94648674020
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 35 (69.9 bits)